Repbase Reports |
---|
2025, Volume 25, Issue 2 |
February 24, 2025 |
Copyright © 2001-2025 - Genetic Information Research Institute, California |
ISSN# 1534-830X |
Page 1652 |
Keno-1_CaAu |
|||
---|---|---|---|
Non-LTR retrotransposon family from the goldfish genome - consensus. |
|||
Submitted: 04-May-2020 |
Accepted: 24-Feb-2025 |
||
Key Words: Tx1; Non-LTR Retrotransposon; Transposable Element; Keno-1_CaAu |
|||
Source: Carassius auratus |
Organism: Carassius auratus |
Taxonomy: Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Cyprinidae; Cyprininae; Carassius |
|
[] |
Authors: Kojima,K.K. |
||
Title: Non-LTR retrotransposons from the goldfish genome. |
|||
Journal: Repbase Reports 25(2), 1652-1652 (2025) |
|||
Abstract: ~99.9% identical to consensus. It follows the sequence GCCTTTTGGCTAAGATCAAG, and is followed by the sequence TCTGTTCTTATCAGTTTAATAT of U2 snRNA gene.
|
|||
Derived: [1] (Consensus) |
|||
Download Sequence - Format: IG, EMBL, FASTA |
|||
References: |