Repbase Reports |
|---|
| 2025, Volume 25, Issue 2 |
| February 24, 2025 |
| Copyright © 2001-2025 - Genetic Information Research Institute, California |
| ISSN# 1534-830X |
| Page 1651 |
Keno-1B_CaAu |
|||
|---|---|---|---|
Non-LTR retrotransposon family from the goldfish genome - consensus. |
|||
|
Submitted: 04-May-2020 |
Accepted: 24-Feb-2025 |
||
|
Key Words: Tx1; Non-LTR Retrotransposon; Transposable Element; Keno-1_CaAu; Keno-1B_CaAu |
|||
|
Source: Carassius auratus |
Organism: Carassius auratus |
Taxonomy: Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Cyprinidae; Cyprininae; Carassius |
|
| [] |
Authors: Kojima,K.K. |
||
|
Title: Non-LTR retrotransposons from the goldfish genome. |
|||
|
Journal: Repbase Reports 25(2), 1651-1651 (2025) |
|||
Abstract: ~99.7% identical to consensus. It follows the sequence CGGCCTTTTGGCTAGATCA, and is followed by the sequence TCTGTTCTTATCAGTTTAATAT of U2 snRNA gene. The consensus is ~89% identical to that of Keno-1_CaAu.
|
|||
|
Derived: [1] (Consensus) |
|||
|
Download Sequence - Format: IG, EMBL, FASTA |
|||
|
References: |
|||