Repbase Reports |
---|
2024, Volume 24, Issue 2 |
February 27, 2024 |
Copyright © 2001-2024 - Genetic Information Research Institute, California |
ISSN# 1534-830X |
Page 1155 |
Mutsu-1_OL |
|||
---|---|---|---|
Non-LTR retrotransposon from the medaka genome - consensus. |
|||
Submitted: 07-May-2020 |
Accepted: 27-Feb-2024 |
||
Key Words: Tx1; Non-LTR Retrotransposon; Transposable Element; Mutsu-1_OL |
|||
Source: Oryzias latipes |
Organism: Oryzias latipes |
Taxonomy: Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Ovalentaria; Atherinomorphae; Beloniformes; Adrianichthyidae; Oryziinae; Oryzias |
|
[] |
Authors: Kojima,K.K. |
||
Title: Non-LTR retrotransposons from the medaka genome. |
|||
Journal: Repbase Reports 24(2), 1155-1155 (2024) |
|||
Abstract: ~100.0% identical to consensus. It is inserted in 5S rRNA genes between GCTTACGGCCATACCACCCTGAACACGC and CACGCCCGATCTCGTCCGAT with TSDs of CACGC.
|
|||
Derived: [1] (Consensus) |
|||
Download Sequence - Format: IG, EMBL, FASTA |
|||
References: |