Repbase Reports |
---|
2020, Volume 20, Issue 3 |
March 30, 2020 |
Copyright © 2001-2020 - Genetic Information Research Institute, California |
ISSN# 1534-830X |
Page 717 |
Helitron-N1B_PaM |
|||
---|---|---|---|
DNA transposon from the proso millet genome - consensus. |
|||
Submitted: 14-Feb-2020 |
Accepted: 30-Mar-2020 |
||
Key Words: Helitron; DNA transposon; Transposable Element; Nonautonomous; Helitron-N1B_PaM |
|||
Source: Panicum miliaceum |
Organism: Panicum miliaceum |
Taxonomy: Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; PACMAD clade; Panicoideae; Panicodae; Paniceae; Panicinae; Panicum |
|
[] |
Authors: Kojima,N.F. and Kojima,K.K. |
||
Title: DNA transposons from the proso millet genome. |
|||
Journal: Repbase Reports 20(3), 717-717 (2020) |
|||
Abstract: ~94% identical to consensus. A|TC..CTAG|T. The consensus is ~98% identical to that of Helitron-N1_PaM, but contains only one repeat unit (CCCCCTAAACATGTATCTAAATTACCCACCTCTGCCATTATAAAATATAATCTAAAGTAA). compared with 2 units in Helitron-N1_PaM.
|
|||
Derived: [1] (Consensus) |
|||
Download Sequence - Format: IG, EMBL, FASTA |
|||
References: |