Repbase Reports |
---|
2015, Volume 15, Issue 10 |
October 31, 2015 |
Copyright © 2001-2016 - Genetic Information Research Institute |
ISSN# 1534-830X |
Page 3503 |
R2-2_RPr |
|||
---|---|---|---|
R2 non-LTR retrotransposon sequence. |
|||
Submitted: 04-Jan-2013 |
Accepted: 31-Oct-2015 |
||
Key Words: R2; Non-LTR Retrotransposon; Transposable Element; R2-2_RPr |
|||
Source: Rhodnius prolixus |
Organism: Rhodnius prolixus |
Taxonomy: Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Paraneoptera; Hemiptera; Euhemiptera; Heteroptera; Panheteroptera; Cimicomorpha; Reduviidae; Triatominae; Rhodnius |
|
[1] |
Authors: Kojima,K.K. and Jurka,J. |
||
Title: R2 non-LTR retrotransposons from Arthropoda, Chordata, Hemichordata, Platyhelminthes and Ctenophora. |
|||
Journal: Repbase Reports 15(10), 3503-3503 (2015) |
|||
Abstract: It is between AGTAAGCGCGGGTCAAGGCG and TAGCCAAATGCCTCGTCATC in a 28S rRNA gene. ACPB02021849 3711-1366.
|
|||
Derived: [1] (Consensus) |
|||
Download Sequence - Format: IG, EMBL, FASTA |
|||
References: |