Repbase Reports |
---|
2014, Volume 14, Issue 6 |
June 30, 2014 |
Copyright © 2001-2016 - Genetic Information Research Institute |
ISSN# 1534-830X |
Page 1835 |
Tx1-50_DR |
|||
---|---|---|---|
Non-LTR retrotransposon from zebrafish - consensus. |
|||
Submitted: 27-Nov-2013 |
Accepted: 06-MAY-2014 |
||
Key Words: Tx1; Non-LTR Retrotransposon; Transposable Element; reverse transcriptase; endonuclease; Tx1-50_DR |
|||
Source: Danio rerio |
Organism: Danio rerio |
Taxonomy: Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Cyprinidae; Danio |
|
[2] |
Authors: Bao,W. and Jurka,J. |
||
Title: Non-LTR retrotransposons from zebrafish. |
|||
Journal: Repbase Reports 14(6), 1835-1835 (2014) |
|||
Abstract: ~98% identical to consensus. Many copies are truncated and parts of tRNA gene array. It follows a fragment of tRNA-Gly (GCATTGGTGGTTTAGTGGTAGAATTCTCGTC).
|
|||
Derived: [2] (Consensus) |
|||
Download Sequence - Format: IG, EMBL, FASTA |
|||
References:
|