Repbase Reports |
---|
2012, Volume 12, Issue 8 |
August 31, 2012 |
Copyright © 2001-2016 - Genetic Information Research Institute |
ISSN# 1534-830X |
Page 1638 |
LT1_EPa |
|||
---|---|---|---|
Short LTR retrotransposon from the Eutrema parvulum genome: consensus. |
|||
Submitted: 02-Sep-2011 |
Accepted: 20-AUG-2012 |
||
Key Words: LTR Retrotransposon; Transposable Element; LT1_EPa |
|||
Source: Eutrema parvulum |
Organism: Eutrema parvulum |
Taxonomy: Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; rosids; malvids; Brassicales; Brassicaceae; Eutremeae; Eutrema |
|
[2] |
Authors: Jurka,J. |
||
Title: LTR retrotransposons from the Eutrema parvulum genome. |
|||
Journal: Repbase Reports 12(8), 1638-1638 (2012) |
|||
Abstract: >89% identical to consensus. 5bp TSD. The element is complete, with short internal portion flanked by LTRs. The internal portion: tggtatcagagcccgatccacacactcttgtaatccggcccaaaaagtggtccgtgctcctggacccgaaattgatggtctggcgagattaatggctagaagagccattatctcgagggggag.
|
|||
Derived: [2] (Consensus) |
|||
Download Sequence - Format: IG, EMBL, FASTA |
|||
References:
|