Repbase Reports |
---|
2012, Volume 12, Issue 3 |
March 31, 2012 |
Copyright © 2001-2016 - Genetic Information Research Institute |
ISSN# 1534-830X |
Page 291 |
piggyBac-3B_DAn |
|||
---|---|---|---|
PiggyBac DNA transposon from fruit flies. |
|||
Submitted: 05-Jan-2012 |
Accepted: 31-Mar-2012 |
||
Key Words: piggyBac; DNA transposon; Transposable Element; piggyBac-3B_DAn |
|||
Source: Drosophila ananassae |
Organism: Drosophila ananassae |
Taxonomy: Eukaryota; Metazoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Diptera; Brachycera; Muscomorpha; Ephydroidea; Drosophilidae; Drosophila; Sophophora; melanogaster group; ananassae subgroup |
|
[2] |
Authors: Kojima,K.K. and Jurka,J. |
||
Title: DNA transposons from Drosophila ananassae. |
|||
Journal: Repbase Reports 12(3), 291-291 (2012) |
|||
Abstract: >99% identical to consensus. 15-bp TIRs. TTAA TSDs. It is quite similar to piggyBac-3_DAn, but is structurally different. Insertion of Helitron-N1_DAn-like sequence between nucleotides 1070-1071 is masked with X. The masked sequence is : tttttatccccttgcagagggtattataattttggtcaaaagtgtgcaacgcagtaaaggagacatctcc gaccctataaagtatatatattcttgatcaggatccccccctgattcgatataagtatgtccgtctgtct gtcggtttctacggaaactagtctctcagttttaaagctatccttgaaacttcgcacacatccttctttt ccttgcaggaagtacataagtcggaacggccgggatcgggcgactatatcctatagctgccatataactg aacgatcgaaaatggcacaact.
|
|||
Derived: [2] (Consensus) |
|||
Download Sequence - Format: IG, EMBL, FASTA |
|||
References:
|