Repbase Reports |
---|
2012, Volume 12, Issue 10 |
October 31, 2012 |
Copyright © 2001-2016 - Genetic Information Research Institute |
ISSN# 1534-830X |
Page 2273 |
Tx1-U5-1_SK |
|||
---|---|---|---|
A Tx1 non-LTR retrotransposon from Saccoglossus kowalevskii - consensus. |
|||
Submitted: 22-Mar-2011 |
Accepted: 31-Oct-2012 |
||
Key Words: Tx1; Non-LTR Retrotransposon; Transposable Element; Tx1-U5-1_SK |
|||
Source: Saccoglossus kowalevskii |
Organism: Saccoglossus kowalevskii |
Taxonomy: Eukaryota; Metazoa; Hemichordata; Enteropneusta; Harrimaniidae; Saccoglossus |
|
[1] |
Authors: Kojima,K.K. and Jurka,J. |
||
Title: U5 small nuclear RNA gene-specific Tx1 non-LTR retrotransposons from the acorn worm. |
|||
Journal: Repbase Reports 12(10), 2273-2273 (2012) |
|||
Abstract: This consensus is generated from 6 sequences with >98% identity. All copies are followed by U5 small nuclear RNA genes started with TCGCCTTTTACTAAAGATTT, where TC is microhomologies with retrotransposon 3' tail. This sequence was derived from sequence data generated by Human Genome Sequencing Center at Baylor College of Medicine: the acorn worm genome.
|
|||
Derived: [1] (Consensus) |
|||
Download Sequence - Format: IG, EMBL, FASTA |
|||
References: |