Repbase Reports |
---|
2012, Volume 12, Issue 10 |
October 31, 2012 |
Copyright © 2001-2016 - Genetic Information Research Institute |
ISSN# 1534-830X |
Page 2188 |
Tx1-Sat-1_SK |
|||
---|---|---|---|
A Tx1 non-LTR retrotransposon family from Saccoglossus kowalevskii - consensus. |
|||
Submitted: 22-Mar-2011 |
Accepted: 31-Oct-2012 |
||
Key Words: Tx1; Non-LTR Retrotransposon; Transposable Element; Tx1-Sat-1_SK |
|||
Source: Saccoglossus kowalevskii |
Organism: Saccoglossus kowalevskii |
Taxonomy: Eukaryota; Metazoa; Hemichordata; Enteropneusta; Harrimaniidae; Saccoglossus |
|
[1] |
Authors: Kojima,K.K. and Jurka,J. |
||
Title: Minisatellite-specific Tx1 non-LTR retrotransposons from the acorn worm. |
|||
Journal: Repbase Reports 12(10), 2188-2188 (2012) |
|||
Abstract: This consensus is generated from 30 sequences with >95% identity. This family is sandwiched by two arrays composed by the same units "TGACGAGAAATGTACTAATTACATGCATCCCAGGGC". Thus it is a minisatellite-specific non-LTR retrotransposon family. This sequence was derived from sequence data generated by Human Genome Sequencing Center at Baylor College of Medicine: the acorn worm genome.
|
|||
Derived: [1] (Consensus) |
|||
Download Sequence - Format: IG, EMBL, FASTA |
|||
References: |