Repbase Reports |
---|
2009, Volume 9, Issue 7 |
July 31, 2009 |
Copyright © 2001-2016 - Genetic Information Research Institute |
ISSN# 1534-830X |
Page 1571 |
REX1-8_XT |
|||
---|---|---|---|
A family of REX1 non-LTR retrotransposons from frogs - incomplete consensus. |
|||
Submitted: 29-Jul-2009 |
Accepted: 31-Jul-2009 |
||
Key Words: Rex1; Non-LTR Retrotransposon; Transposable Element; REX1-8_XT |
|||
Source: Xenopus tropicalis |
Organism: Xenopus tropicalis |
Taxonomy: Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Amphibia; Batrachia; Anura; Mesobatrachia; Pipoidea; Pipidae; Xenopodinae; Xenopus; Silurana |
|
[1] |
Authors: Kapitonov,V.V. and Jurka,J. |
||
Title: REX1 non-LTR retrotransposons from in the frog genome. |
|||
Journal: Repbase Reports 9(7), 1571-1571 (2009) |
|||
Abstract: This family was active some millions of years ago: copies of REX1-8_XT are ~95% identical to the consensus sequence. The 3' terminus is composed of the (CACTTATTTTAACTTCACTG)n minisatellite. The REX1-8_XT CDS is damaged by mutations. The consensus sequence is incomplete at the 5' terminus.
|
|||
Derived: [1] (Consensus) |
|||
Download Sequence - Format: IG, EMBL, FASTA |
|||
References: |