Repbase Reports |
|---|
| 2006, Volume 6, Issue 9 |
| September 30, 2006 |
| Copyright © 2001-2016 - Genetic Information Research Institute |
| ISSN# 1534-830X |
| Page 469 |
hAT-N2A_XT |
|||
|---|---|---|---|
A nonautonomous family of hAT transposons - a consensus. |
|||
|
Submitted: 29-Sep-2006 |
Accepted: 30-Sep-2006 |
||
|
Key Words: hAT; DNA transposon; Interspersed Repeat; Nonautonomous; non-autonomous; hAT-N2_XT; hAT-N2A_XT |
|||
|
Source: Xenopus tropicalis |
Organism: Xenopus tropicalis |
Taxonomy: Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Amphibia; Batrachia; Anura; Mesobatrachia; Pipoidea; Pipidae; Xenopodinae; Xenopus; Silurana |
|
| [1] |
Authors: Kapitonov,V.V. and Jurka,J. |
||
|
Title: hAT-N2A_XT, a minisatellite-propagating subfamily of nonautonomous hAT DNA transposons from frog. |
|||
|
Journal: Repbase Reports 6(9), 469-469 (2006) |
|||
Abstract: The genome contains thousands of copies of the hAT-N2A_XT nonautonomous DNA transposon. These elements have been transposed long time ago (they are >20% divergent from the consensus sequence). This transposon is characterized by 8-bp TSDs and 15-bp TIRs. The hAT-N2A_XT and hAT-N2_XT consensus sequences share the 78% identical 150-bp and 80-bp 5' and 3' termini. Numerous copies of hAT-N2A_XT contain the (TTTTGACGCGACCATGCCCA)n minisatellites.
|
|||
|
Derived: [1] (Consensus) |
|||
|
Download Sequence - Format: IG, EMBL, FASTA |
|||
|
References: |
|||