Repbase Reports |
|---|
| 2006, Volume 6, Issue 10 |
| October 31, 2006 |
| Copyright © 2001-2016 - Genetic Information Research Institute |
| ISSN# 1534-830X |
| Page 511 |
TS2 |
|||
|---|---|---|---|
Solanum DNA, short interspersed repetitive element, TS family. |
|||
|
Submitted: 20-Oct-2006 |
Accepted: 24-OCT-2006 |
||
|
Key Words: SINE; Non-LTR Retrotransposon; Interspersed Repeat; TS2 |
|||
|
Source: Solanum demissum |
Organism: Solanum demissum |
Taxonomy: Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicots; asterids; lamiids; Solanales; Solanaceae; Solanum |
|
| [1] |
Authors: Shankar,R. and Jurka,J. |
||
|
Title: TS2: A SINE subfamily from Solanum demissum related to TS. |
|||
|
Journal: Repbase Reports 6(10), 511-511 (2006) |
|||
Abstract: This sequence is relatively new. It has got 27 bp long target site sequence (TTGAGACCTCAATAACCATTTATCACA).
|
|||
|
Derived: [1] (Consensus) |
|||
|
Download Sequence - Format: IG, EMBL, FASTA |
|||
|
References: |
|||