Repbase Reports |
|---|
| 2003, Volume 3, Issue 6 |
| June 30, 2003 |
| Copyright © 2001-2016 - Genetic Information Research Institute |
| ISSN# 1534-830X |
| Page 106 |
HAT5N_CI |
|||
|---|---|---|---|
Nonautonomous DNA transposon HAT5N_CI - a consensus. |
|||
|
Submitted: 30-Jun-2003 |
Accepted: 30-Jun-2003 |
||
|
Key Words: Nonautonomous DNA transposon, hAT superfamily; 8-bp target site duplication; HAT5; HAT5N_CI |
|||
|
Source: consensus |
Organism: Ciona intestinalis |
Taxonomy: Eukaryota; Metazoa; Chordata; Urochordata; Ascidiacea; Enterogona; Phlebobranchia; Cionidae; Ciona |
|
| [1] |
Authors: Kapitonov,V.V. and Jurka,J. |
||
|
Title: HAT5N_CI, a family of nonautonomous hAT-like DNA transposons from the sea squirt Ciona intestinalis |
|||
|
Journal: Repbase Reports 3:(6) p. 106 (2003) |
|||
Abstract: There are ~50 HAT5N_CI elements in the C. intestinalis genome, they are ~85% identical to the consensus. HAT5N_CI has ~100-bp degenerative terminal inverted repeats. HAT5N_CI elements are flanked by 8-bp target site duplications. HAT5N_CI is a nonautonomous derivate of the HAT5 transposon. They share common ~100-bp 5' and ~140-bp 3' termini, respectively. The 23-bp CGTGCGTCGTAGTTTGACCTTTA minisatellite is present in HAT5N.
|
|||
|
Derived: [1] (Consensus) |
|||
|
Download Sequence - Format: IG, EMBL, FASTA |
|||
|
References: |
|||